Recombinant:Article Title: Chasing Tails: Cathepsin-L Improves Structural Analysis of Histones by HX-MS
Article Snippet: .. Human recombinant histones (H2A3; {"type":"entrez-protein","attrs":{"text":"Q7L7L0","term_id":"74749897","term_text":"Q7L7L0"}} Q7L7L0 (M2502S), H2B2E; {"type":"entrez-protein","attrs":{"text":"Q16778","term_id":"7387736","term_text":"Q16778"}} Q16778 (M2505S), H3.1; {"type":"entrez-protein","attrs":{"text":"P68431","term_id":"55977055","term_text":"P68431"}} P68431 (M2503S) and H4; {"type":"entrez-protein","attrs":{"text":"P62805","term_id":"51317339","term_text":"P62805"}} P62805 (M2504S)) were purchased from New England BioLabs Inc (Ipswich, MA). .. Mononucleosomes, recombinant human (16–0009) containing H2A1B ( {"type":"entrez-protein","attrs":{"text":"P04908","term_id":"124028530","term_text":"P04908"}} P04908 ), H2B1K ( {"type":"entrez-protein","attrs":{"text":"O60814","term_id":"51701495","term_text":"O60814"}} O60814 ), H3.1 ( {"type":"entrez-protein","attrs":{"text":"P68431","term_id":"55977055","term_text":"P68431"}} P68431 ), and H4 ( {"type":"entrez-protein","attrs":{"text":"P62805","term_id":"51317339","term_text":"P62805"}} P62805 ) were purchased from EpiCypher (Durham, NC).
Article Title: Resolving the 3D landscape of transcription-linked mammalian chromatin folding
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-POLR2A (ChIP) Santa Cruz Biotechnology sc-899 RRID: AB_632359 Chemicals, Peptides, and Recombinant Proteins 10 mM ATP New England Biolabs Cat. # P0756S 10 mM dNTPs KAPA Biosystems Cat. # KK1017 100mM ATP ThermoFisher Scientific Cat. # R1441 Proteinase K ThermoFisher Scientific Cat. # AM2542 AMPure XP beads Agencourt Cat. # A63880 Biotin-11-dCTP Jena Bioscience Cat. # NU-809-BIOX Biotin-14-dATP Jena Bioscience Cat. # NU-835-BIO14 DNA Polymerase I, Large (Klenow) Fragment New England Biolabs Cat. # M0210 DSG (disuccinimidyl glutarate) ThermoFisher Scientific Cat. # 20593 Dynabeads® MyOne Streptavidin C1 ThermoFisher Scientific Cat. # 65001 Exonuclease III (E. coli) New England Biolabs Cat. # M0206 Flavopiridol Santa Cruz Cat. # sc-202157 Formaldehyde Polysciences Cat. # 1881420 KAPA HiFi HotStart ReadyMix KAPA Biosystems Cat. # KK2601 KAPA HS HIFI polymerase KAPA Biosystems Cat. # KK2502 KAPA SYBR FAST qPCR Master Mix (2X) KAPA Biosystems Cat. # KK4602 Micrococcal Nuclease Worthington Biochem Cat. # {"type":"entrez-nucleotide","attrs":{"text":"LS004798","term_id":"1321649926","term_text":"LS004798"}} LS004798 NP-40 Alternative Millipore Cat. # 492018 NuSieve GTG Agarose Lonza Cat. # 50081 Protease Inhibitor Cocktail Sigma Cat. # 5056489001 QubitTM dsDNA HS Assay Kit ThermoFisher Scientific Cat. # {"type":"entrez-protein","attrs":{"text":"Q32851","term_id":"75280859","term_text":"Q32851"}} Q32851 Rapid DNA ligase Enzymatics Cat. # L6030-HC-L T4 DNA Ligase New England Biolabs Cat. # M0202 T4 DNA polymerase Invitrogen Cat. # 18005025 T4 Polynucleotide Kinase New England Biolabs Cat. # M0201 Triptolide Sigma Cat. # T3652 Critical Commercial Assays NEBNext Ultra II New England Biolabs Cat. # E7645 End-It DNA End-Repair Lucigen Cat. # ER81050 Deposited Data Micro-C and ChIP-seq: Raw fastq files This study {"type":"entrez-geo","attrs":{"text":"GSE130275","term_id":"130275"}} GSE130275 Micro-C: Raw valid pairs, Cooler, Juicer files This study {"type":"entrez-geo","attrs":{"text":"GSE130275","term_id":"130275"}} GSE130275 Published genome-wide data. .. See Table S3 N/A N/A Experimental Models: Cell Lines Mouse: JM8.N4 mouse embryonic stem cells ( Pettitt et al., 2009 ) and UC Davis KOMP Repository https://www.komp.org/pdf.php?cloneID=8669 Oligonucleotides See Table S7 This study N/A Software and Algorithms MATLAB 2018b The Mathworks 2018b Python 3.7 Python https://www.python.org/ Jupyter notebook Jupyter https://jupyter.org/ Integrative Genomics Viewer (Robinson et al., 2011; Thorvaldsdóttir et al., 2013) RRID:SCR_011793 FastQC http://www.bioinformatics.babraham.ac.uk/projects/fastqc RRID:SCR_014583 Bowtie (Langmead et al., 2009) RRID:SCR_005476 Samtools (Li et al., 2009) RRID:SCR_002105 HOMER ( Heinz et al., 2010 ) http://homer.ucsd.edu/homer/ DeepTools (Ramirez et al., 2016) RRID:SCR_016366 BedTools (Quinlan et al., 2010) RRID:SCR_006646 HiC-Pro ( Servant et al., 2015 ) https://github.com/nservant/HiC-Pro Cooler ( Abdennur and Mirny, 2019 ) https://github.com/mirnylab/cooler Juicer tools (Durand et al., 2016) https://github.com/aidenlab/juicer Higlass ( Kerpedjiev et al., 2018 ) http://higlass.io/ Cooltools Mirny Lab https://github.com/mirnylab/cooltools Open in a separate window KEY RESOURCES TABLE Micro-C resolves mammalian chromatin folding down to single nucleosomes Nested structures are the prevalent folding feature within TADs Transcription drives short-range interactions connecting enhancers and promoters Only a subset of fine-scale structures appears to be CTCF and cohesin specific
Article Title: NELF regulates a promoter-proximal step distinct from RNA Pol II pause-release
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TH1L (D5G6W) Rabbit mAb (NELFC/D) Cell Signaling Cell Signaling Technology Cat# 12265, RRID:AB_2797862 Recombinant Anti-NELFe antibody [ {"type":"entrez-protein","attrs":{"text":"EPR11600","term_id":"523377171","term_text":"EPR11600"}} EPR11600 ] Abcam Abcam Cat# ab170104, RRID:AB_2827280 Purified Mouse Anti-DSIF Clone 17/DSIF (SPT5) BD Biosciences BD Biosciences Cat# 611107, RRID:AB_398420 Anti-RNA polymerase II subunit B1 (phospho CTD Ser-2), clone 3E10 Millipore Millipore Cat# 04-1571, RRID:AB_11212363 Anti-RNA polymerase II subunit B1 (phospho-CTD Ser-5), clone 3E8 Millipore Millipore Cat# 04-1572, RRID:AB_10615822 NCBP1/CBP80 Antibody Bethyl Bethyl Cat# A301-793A, RRID:AB_1211224 XRN2 antibody Bethyl Bethyl Cat# A301-103A, RRID:AB_2218876 DCP2 antibody Bethyl Bethyl Cat# A302-597A, RRID:AB_10555903 HSP 90alpha/beta (F-8) antibody Santa Cruz Biotechnology Santa Cruz Biotechnology Cat# sc-13119, RRID:AB_675659 Anti-Tubulin, beta E7 DSHB DSHB Cat# E7, RRID:AB_528499 Rabbit anti-H3K4me3 serum Shilatifard Laboratory Chemicals, Peptides, and Recombinant Proteins Flavopiridol Cayman Cat# 10009197 3-indole-acetic acid sodium salt Abcam Cat# ab146403 NVP-2 MedChemExpress Cat# HY-12214A Paraformaldehyde (Electron Microscopy Sciences) Fisher Scientific Cat# 50-980-487 Biotin-11-ATP PerkinElmer Cat# NEL544001EA Biotin-11-CTP PerkinElmer Cat# NEL542001EA Biotin-11-GTP PerkinElmer Cat# NEL545001EA Biotin-11-UTP PerkinElmer Cat# NEL543001EA RNA 5’ Pyrophosphohydrolase (RppH) NEB Cat# M0356S PNK NEB Cat# M0201L T4 RNA ligase I NEB Cat# M0204L Phusion Hot Start II DNA polymerase ThermoFisher Cat# F549S Terminator 5’-triphosphate dependent exonuclease Lucigen Cat# {"type":"entrez-protein","attrs":{"text":"TER51020","term_id":"1599868412","term_text":"TER51020"}} TER51020 Quick CIP NEB Cat# M0525S Proteinase K Roche Cat# 3115828001 Dynabeads Protein G ThermoFisher Cat# 10003D Protein A/G PLUS-Agarose Santa Cruz Biotechnology Cat# sc-2003 Dynabeads Streptavidin M-280 ThermoFisher Cat# 11205D 2% Agarose, PippinHT, 100-600 bp.10/pkg. .. Sage science Cat# HTC2010 Critical Commercial Assays HTP Library Preparation Kit KAPA Biosciences Cat# KK8234 Agencourt AMPure XP Beckman Coulter Cat# A63882 Deposited Data Raw and processed data This paper GEO: {"type":"entrez-geo","attrs":{"text":"GSE144786","term_id":"144786"}} GSE144786 Human reference genome GRCh37/hg19 Genome Reference Consortium https://www.ncbi.nlm.nih.gov/grc/human Drosophila reference genome BDGP Release 5/dm3 Genome Reference Consortium Ensembl version 75 http://www.ensembl.org/ RNAPII-nucleosome structure SHL(−5) ( Kujirai et al., 2018 ) PDB: 6A5P RNAPII-nucleosome structure SHL (−1) ( Kujirai et al., 2018 ) PDB: 6A5T Pol II-NELF structure {Vos:2018cp} PDB: 6GML Complex of human nuclear cap-binding complex with m7GTP and NELFe c-terminal peptide ( Schulze and Cusack, 2017 ) PDB: 5OOB DLD1_normoxia_nucleosome ( Yamashita et al., 2011 ) https://www.ncbi.nlm.nih.gov/sra/DRX000003 Experimental Models: Cell Lines DLD-1 OsTIR1 ( Holland et al., 2012 ) N/A NELF-C-AID DLD-1 OsTIR1 #7-10B This paper N/A NELF-E-AID DLD-1 OsTIR1 #20-1B This paper N/A Mouse embryonic fibroblasts Stem cell technology cat# 00325 S2-DGRC DGRC FlyBase: FBtc0000006 Recombinant DNA YNP37 (Donor plasmid: NELF-C-AID_Neo) This paper N/A YNP38 (Donor plasmid: NELF-C-AID_Hyg) This paper N/A YNP39 (Cas9 plasmid for NELF-C, gRNA: CTGCAAATCTAACTTCATCA) This paper N/A YNP41 (Cas9 for NELF-E, gRNA: CTACAGTGATGACGTCTACA) This paper N/A YNP47 (Donor plasmid: NELF-E-AID_Neo) This paper N/A YNP48 (Donor plasmid: NELF-E-AID_Hyg) This paper N/A Software and Algorithms Bowtie 2.2.6 ( Langmead and Salzberg, 2012 ) BEDTools 2.25.0 ( Quinlan and Hall, 2010 ) R 3.3.3 https://www.r-project.org/ deepTools 3.0.0/3.1.1/3.1.2 ( Ramírez et al., 2016 ) Bowtie 1.1.2 ( Langmead et al., 2009 ) iNPS 1.2.2 ( Chen et al., 2014 ) HOMER 4.10/4.11 ( Duttke et al., 2019 ; Heinz et al., 2010 ) RUVseq ( Risso et al., 2014 ) DESeq2 ( Love et al., 2014 ) Trimmomatic 0.33 ( Bolger et al., 2014 ) cutadapt 1.14 ( Martin, 2011 ) intervene 0.6.4 ( Khan and Mathelier, 2017 ) featureCounts 2.0.0 ( Liao et al., 2014 ) Open in a separate window KEY RESOURCES TABLE Acute NELF depletion reveals a 2-step pausing of Pol II at promoters The 1st to 2nd pausing transition is independent of P-TEFb/SEC activity The heat shock response remains intact in the absence of NELF NELF recruits the cap binding complex with modest effects on 5’ cap stability
Chromatin Immunoprecipitation:Article Title: Resolving the 3D landscape of transcription-linked mammalian chromatin folding
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-POLR2A (ChIP) Santa Cruz Biotechnology sc-899 RRID: AB_632359 Chemicals, Peptides, and Recombinant Proteins 10 mM ATP New England Biolabs Cat. # P0756S 10 mM dNTPs KAPA Biosystems Cat. # KK1017 100mM ATP ThermoFisher Scientific Cat. # R1441 Proteinase K ThermoFisher Scientific Cat. # AM2542 AMPure XP beads Agencourt Cat. # A63880 Biotin-11-dCTP Jena Bioscience Cat. # NU-809-BIOX Biotin-14-dATP Jena Bioscience Cat. # NU-835-BIO14 DNA Polymerase I, Large (Klenow) Fragment New England Biolabs Cat. # M0210 DSG (disuccinimidyl glutarate) ThermoFisher Scientific Cat. # 20593 Dynabeads® MyOne Streptavidin C1 ThermoFisher Scientific Cat. # 65001 Exonuclease III (E. coli) New England Biolabs Cat. # M0206 Flavopiridol Santa Cruz Cat. # sc-202157 Formaldehyde Polysciences Cat. # 1881420 KAPA HiFi HotStart ReadyMix KAPA Biosystems Cat. # KK2601 KAPA HS HIFI polymerase KAPA Biosystems Cat. # KK2502 KAPA SYBR FAST qPCR Master Mix (2X) KAPA Biosystems Cat. # KK4602 Micrococcal Nuclease Worthington Biochem Cat. # {"type":"entrez-nucleotide","attrs":{"text":"LS004798","term_id":"1321649926","term_text":"LS004798"}} LS004798 NP-40 Alternative Millipore Cat. # 492018 NuSieve GTG Agarose Lonza Cat. # 50081 Protease Inhibitor Cocktail Sigma Cat. # 5056489001 QubitTM dsDNA HS Assay Kit ThermoFisher Scientific Cat. # {"type":"entrez-protein","attrs":{"text":"Q32851","term_id":"75280859","term_text":"Q32851"}} Q32851 Rapid DNA ligase Enzymatics Cat. # L6030-HC-L T4 DNA Ligase New England Biolabs Cat. # M0202 T4 DNA polymerase Invitrogen Cat. # 18005025 T4 Polynucleotide Kinase New England Biolabs Cat. # M0201 Triptolide Sigma Cat. # T3652 Critical Commercial Assays NEBNext Ultra II New England Biolabs Cat. # E7645 End-It DNA End-Repair Lucigen Cat. # ER81050 Deposited Data Micro-C and ChIP-seq: Raw fastq files This study {"type":"entrez-geo","attrs":{"text":"GSE130275","term_id":"130275"}} GSE130275 Micro-C: Raw valid pairs, Cooler, Juicer files This study {"type":"entrez-geo","attrs":{"text":"GSE130275","term_id":"130275"}} GSE130275 Published genome-wide data. .. See Table S3 N/A N/A Experimental Models: Cell Lines Mouse: JM8.N4 mouse embryonic stem cells ( Pettitt et al., 2009 ) and UC Davis KOMP Repository https://www.komp.org/pdf.php?cloneID=8669 Oligonucleotides See Table S7 This study N/A Software and Algorithms MATLAB 2018b The Mathworks 2018b Python 3.7 Python https://www.python.org/ Jupyter notebook Jupyter https://jupyter.org/ Integrative Genomics Viewer (Robinson et al., 2011; Thorvaldsdóttir et al., 2013) RRID:SCR_011793 FastQC http://www.bioinformatics.babraham.ac.uk/projects/fastqc RRID:SCR_014583 Bowtie (Langmead et al., 2009) RRID:SCR_005476 Samtools (Li et al., 2009) RRID:SCR_002105 HOMER ( Heinz et al., 2010 ) http://homer.ucsd.edu/homer/ DeepTools (Ramirez et al., 2016) RRID:SCR_016366 BedTools (Quinlan et al., 2010) RRID:SCR_006646 HiC-Pro ( Servant et al., 2015 ) https://github.com/nservant/HiC-Pro Cooler ( Abdennur and Mirny, 2019 ) https://github.com/mirnylab/cooler Juicer tools (Durand et al., 2016) https://github.com/aidenlab/juicer Higlass ( Kerpedjiev et al., 2018 ) http://higlass.io/ Cooltools Mirny Lab https://github.com/mirnylab/cooltools Open in a separate window KEY RESOURCES TABLE Micro-C resolves mammalian chromatin folding down to single nucleosomes Nested structures are the prevalent folding feature within TADs Transcription drives short-range interactions connecting enhancers and promoters Only a subset of fine-scale structures appears to be CTCF and cohesin specific
Real-time Polymerase Chain Reaction:Article Title: Resolving the 3D landscape of transcription-linked mammalian chromatin folding
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-POLR2A (ChIP) Santa Cruz Biotechnology sc-899 RRID: AB_632359 Chemicals, Peptides, and Recombinant Proteins 10 mM ATP New England Biolabs Cat. # P0756S 10 mM dNTPs KAPA Biosystems Cat. # KK1017 100mM ATP ThermoFisher Scientific Cat. # R1441 Proteinase K ThermoFisher Scientific Cat. # AM2542 AMPure XP beads Agencourt Cat. # A63880 Biotin-11-dCTP Jena Bioscience Cat. # NU-809-BIOX Biotin-14-dATP Jena Bioscience Cat. # NU-835-BIO14 DNA Polymerase I, Large (Klenow) Fragment New England Biolabs Cat. # M0210 DSG (disuccinimidyl glutarate) ThermoFisher Scientific Cat. # 20593 Dynabeads® MyOne Streptavidin C1 ThermoFisher Scientific Cat. # 65001 Exonuclease III (E. coli) New England Biolabs Cat. # M0206 Flavopiridol Santa Cruz Cat. # sc-202157 Formaldehyde Polysciences Cat. # 1881420 KAPA HiFi HotStart ReadyMix KAPA Biosystems Cat. # KK2601 KAPA HS HIFI polymerase KAPA Biosystems Cat. # KK2502 KAPA SYBR FAST qPCR Master Mix (2X) KAPA Biosystems Cat. # KK4602 Micrococcal Nuclease Worthington Biochem Cat. # {"type":"entrez-nucleotide","attrs":{"text":"LS004798","term_id":"1321649926","term_text":"LS004798"}} LS004798 NP-40 Alternative Millipore Cat. # 492018 NuSieve GTG Agarose Lonza Cat. # 50081 Protease Inhibitor Cocktail Sigma Cat. # 5056489001 QubitTM dsDNA HS Assay Kit ThermoFisher Scientific Cat. # {"type":"entrez-protein","attrs":{"text":"Q32851","term_id":"75280859","term_text":"Q32851"}} Q32851 Rapid DNA ligase Enzymatics Cat. # L6030-HC-L T4 DNA Ligase New England Biolabs Cat. # M0202 T4 DNA polymerase Invitrogen Cat. # 18005025 T4 Polynucleotide Kinase New England Biolabs Cat. # M0201 Triptolide Sigma Cat. # T3652 Critical Commercial Assays NEBNext Ultra II New England Biolabs Cat. # E7645 End-It DNA End-Repair Lucigen Cat. # ER81050 Deposited Data Micro-C and ChIP-seq: Raw fastq files This study {"type":"entrez-geo","attrs":{"text":"GSE130275","term_id":"130275"}} GSE130275 Micro-C: Raw valid pairs, Cooler, Juicer files This study {"type":"entrez-geo","attrs":{"text":"GSE130275","term_id":"130275"}} GSE130275 Published genome-wide data. .. See Table S3 N/A N/A Experimental Models: Cell Lines Mouse: JM8.N4 mouse embryonic stem cells ( Pettitt et al., 2009 ) and UC Davis KOMP Repository https://www.komp.org/pdf.php?cloneID=8669 Oligonucleotides See Table S7 This study N/A Software and Algorithms MATLAB 2018b The Mathworks 2018b Python 3.7 Python https://www.python.org/ Jupyter notebook Jupyter https://jupyter.org/ Integrative Genomics Viewer (Robinson et al., 2011; Thorvaldsdóttir et al., 2013) RRID:SCR_011793 FastQC http://www.bioinformatics.babraham.ac.uk/projects/fastqc RRID:SCR_014583 Bowtie (Langmead et al., 2009) RRID:SCR_005476 Samtools (Li et al., 2009) RRID:SCR_002105 HOMER ( Heinz et al., 2010 ) http://homer.ucsd.edu/homer/ DeepTools (Ramirez et al., 2016) RRID:SCR_016366 BedTools (Quinlan et al., 2010) RRID:SCR_006646 HiC-Pro ( Servant et al., 2015 ) https://github.com/nservant/HiC-Pro Cooler ( Abdennur and Mirny, 2019 ) https://github.com/mirnylab/cooler Juicer tools (Durand et al., 2016) https://github.com/aidenlab/juicer Higlass ( Kerpedjiev et al., 2018 ) http://higlass.io/ Cooltools Mirny Lab https://github.com/mirnylab/cooltools Open in a separate window KEY RESOURCES TABLE Micro-C resolves mammalian chromatin folding down to single nucleosomes Nested structures are the prevalent folding feature within TADs Transcription drives short-range interactions connecting enhancers and promoters Only a subset of fine-scale structures appears to be CTCF and cohesin specific
Protease Inhibitor:Article Title: Resolving the 3D landscape of transcription-linked mammalian chromatin folding
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-POLR2A (ChIP) Santa Cruz Biotechnology sc-899 RRID: AB_632359 Chemicals, Peptides, and Recombinant Proteins 10 mM ATP New England Biolabs Cat. # P0756S 10 mM dNTPs KAPA Biosystems Cat. # KK1017 100mM ATP ThermoFisher Scientific Cat. # R1441 Proteinase K ThermoFisher Scientific Cat. # AM2542 AMPure XP beads Agencourt Cat. # A63880 Biotin-11-dCTP Jena Bioscience Cat. # NU-809-BIOX Biotin-14-dATP Jena Bioscience Cat. # NU-835-BIO14 DNA Polymerase I, Large (Klenow) Fragment New England Biolabs Cat. # M0210 DSG (disuccinimidyl glutarate) ThermoFisher Scientific Cat. # 20593 Dynabeads® MyOne Streptavidin C1 ThermoFisher Scientific Cat. # 65001 Exonuclease III (E. coli) New England Biolabs Cat. # M0206 Flavopiridol Santa Cruz Cat. # sc-202157 Formaldehyde Polysciences Cat. # 1881420 KAPA HiFi HotStart ReadyMix KAPA Biosystems Cat. # KK2601 KAPA HS HIFI polymerase KAPA Biosystems Cat. # KK2502 KAPA SYBR FAST qPCR Master Mix (2X) KAPA Biosystems Cat. # KK4602 Micrococcal Nuclease Worthington Biochem Cat. # {"type":"entrez-nucleotide","attrs":{"text":"LS004798","term_id":"1321649926","term_text":"LS004798"}} LS004798 NP-40 Alternative Millipore Cat. # 492018 NuSieve GTG Agarose Lonza Cat. # 50081 Protease Inhibitor Cocktail Sigma Cat. # 5056489001 QubitTM dsDNA HS Assay Kit ThermoFisher Scientific Cat. # {"type":"entrez-protein","attrs":{"text":"Q32851","term_id":"75280859","term_text":"Q32851"}} Q32851 Rapid DNA ligase Enzymatics Cat. # L6030-HC-L T4 DNA Ligase New England Biolabs Cat. # M0202 T4 DNA polymerase Invitrogen Cat. # 18005025 T4 Polynucleotide Kinase New England Biolabs Cat. # M0201 Triptolide Sigma Cat. # T3652 Critical Commercial Assays NEBNext Ultra II New England Biolabs Cat. # E7645 End-It DNA End-Repair Lucigen Cat. # ER81050 Deposited Data Micro-C and ChIP-seq: Raw fastq files This study {"type":"entrez-geo","attrs":{"text":"GSE130275","term_id":"130275"}} GSE130275 Micro-C: Raw valid pairs, Cooler, Juicer files This study {"type":"entrez-geo","attrs":{"text":"GSE130275","term_id":"130275"}} GSE130275 Published genome-wide data. .. See Table S3 N/A N/A Experimental Models: Cell Lines Mouse: JM8.N4 mouse embryonic stem cells ( Pettitt et al., 2009 ) and UC Davis KOMP Repository https://www.komp.org/pdf.php?cloneID=8669 Oligonucleotides See Table S7 This study N/A Software and Algorithms MATLAB 2018b The Mathworks 2018b Python 3.7 Python https://www.python.org/ Jupyter notebook Jupyter https://jupyter.org/ Integrative Genomics Viewer (Robinson et al., 2011; Thorvaldsdóttir et al., 2013) RRID:SCR_011793 FastQC http://www.bioinformatics.babraham.ac.uk/projects/fastqc RRID:SCR_014583 Bowtie (Langmead et al., 2009) RRID:SCR_005476 Samtools (Li et al., 2009) RRID:SCR_002105 HOMER ( Heinz et al., 2010 ) http://homer.ucsd.edu/homer/ DeepTools (Ramirez et al., 2016) RRID:SCR_016366 BedTools (Quinlan et al., 2010) RRID:SCR_006646 HiC-Pro ( Servant et al., 2015 ) https://github.com/nservant/HiC-Pro Cooler ( Abdennur and Mirny, 2019 ) https://github.com/mirnylab/cooler Juicer tools (Durand et al., 2016) https://github.com/aidenlab/juicer Higlass ( Kerpedjiev et al., 2018 ) http://higlass.io/ Cooltools Mirny Lab https://github.com/mirnylab/cooltools Open in a separate window KEY RESOURCES TABLE Micro-C resolves mammalian chromatin folding down to single nucleosomes Nested structures are the prevalent folding feature within TADs Transcription drives short-range interactions connecting enhancers and promoters Only a subset of fine-scale structures appears to be CTCF and cohesin specific
Genome Wide:Article Title: Resolving the 3D landscape of transcription-linked mammalian chromatin folding
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-POLR2A (ChIP) Santa Cruz Biotechnology sc-899 RRID: AB_632359 Chemicals, Peptides, and Recombinant Proteins 10 mM ATP New England Biolabs Cat. # P0756S 10 mM dNTPs KAPA Biosystems Cat. # KK1017 100mM ATP ThermoFisher Scientific Cat. # R1441 Proteinase K ThermoFisher Scientific Cat. # AM2542 AMPure XP beads Agencourt Cat. # A63880 Biotin-11-dCTP Jena Bioscience Cat. # NU-809-BIOX Biotin-14-dATP Jena Bioscience Cat. # NU-835-BIO14 DNA Polymerase I, Large (Klenow) Fragment New England Biolabs Cat. # M0210 DSG (disuccinimidyl glutarate) ThermoFisher Scientific Cat. # 20593 Dynabeads® MyOne Streptavidin C1 ThermoFisher Scientific Cat. # 65001 Exonuclease III (E. coli) New England Biolabs Cat. # M0206 Flavopiridol Santa Cruz Cat. # sc-202157 Formaldehyde Polysciences Cat. # 1881420 KAPA HiFi HotStart ReadyMix KAPA Biosystems Cat. # KK2601 KAPA HS HIFI polymerase KAPA Biosystems Cat. # KK2502 KAPA SYBR FAST qPCR Master Mix (2X) KAPA Biosystems Cat. # KK4602 Micrococcal Nuclease Worthington Biochem Cat. # {"type":"entrez-nucleotide","attrs":{"text":"LS004798","term_id":"1321649926","term_text":"LS004798"}} LS004798 NP-40 Alternative Millipore Cat. # 492018 NuSieve GTG Agarose Lonza Cat. # 50081 Protease Inhibitor Cocktail Sigma Cat. # 5056489001 QubitTM dsDNA HS Assay Kit ThermoFisher Scientific Cat. # {"type":"entrez-protein","attrs":{"text":"Q32851","term_id":"75280859","term_text":"Q32851"}} Q32851 Rapid DNA ligase Enzymatics Cat. # L6030-HC-L T4 DNA Ligase New England Biolabs Cat. # M0202 T4 DNA polymerase Invitrogen Cat. # 18005025 T4 Polynucleotide Kinase New England Biolabs Cat. # M0201 Triptolide Sigma Cat. # T3652 Critical Commercial Assays NEBNext Ultra II New England Biolabs Cat. # E7645 End-It DNA End-Repair Lucigen Cat. # ER81050 Deposited Data Micro-C and ChIP-seq: Raw fastq files This study {"type":"entrez-geo","attrs":{"text":"GSE130275","term_id":"130275"}} GSE130275 Micro-C: Raw valid pairs, Cooler, Juicer files This study {"type":"entrez-geo","attrs":{"text":"GSE130275","term_id":"130275"}} GSE130275 Published genome-wide data. .. See Table S3 N/A N/A Experimental Models: Cell Lines Mouse: JM8.N4 mouse embryonic stem cells ( Pettitt et al., 2009 ) and UC Davis KOMP Repository https://www.komp.org/pdf.php?cloneID=8669 Oligonucleotides See Table S7 This study N/A Software and Algorithms MATLAB 2018b The Mathworks 2018b Python 3.7 Python https://www.python.org/ Jupyter notebook Jupyter https://jupyter.org/ Integrative Genomics Viewer (Robinson et al., 2011; Thorvaldsdóttir et al., 2013) RRID:SCR_011793 FastQC http://www.bioinformatics.babraham.ac.uk/projects/fastqc RRID:SCR_014583 Bowtie (Langmead et al., 2009) RRID:SCR_005476 Samtools (Li et al., 2009) RRID:SCR_002105 HOMER ( Heinz et al., 2010 ) http://homer.ucsd.edu/homer/ DeepTools (Ramirez et al., 2016) RRID:SCR_016366 BedTools (Quinlan et al., 2010) RRID:SCR_006646 HiC-Pro ( Servant et al., 2015 ) https://github.com/nservant/HiC-Pro Cooler ( Abdennur and Mirny, 2019 ) https://github.com/mirnylab/cooler Juicer tools (Durand et al., 2016) https://github.com/aidenlab/juicer Higlass ( Kerpedjiev et al., 2018 ) http://higlass.io/ Cooltools Mirny Lab https://github.com/mirnylab/cooltools Open in a separate window KEY RESOURCES TABLE Micro-C resolves mammalian chromatin folding down to single nucleosomes Nested structures are the prevalent folding feature within TADs Transcription drives short-range interactions connecting enhancers and promoters Only a subset of fine-scale structures appears to be CTCF and cohesin specific
other:
Purification:Article Title: NELF regulates a promoter-proximal step distinct from RNA Pol II pause-release
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TH1L (D5G6W) Rabbit mAb (NELFC/D) Cell Signaling Cell Signaling Technology Cat# 12265, RRID:AB_2797862 Recombinant Anti-NELFe antibody [ {"type":"entrez-protein","attrs":{"text":"EPR11600","term_id":"523377171","term_text":"EPR11600"}} EPR11600 ] Abcam Abcam Cat# ab170104, RRID:AB_2827280 Purified Mouse Anti-DSIF Clone 17/DSIF (SPT5) BD Biosciences BD Biosciences Cat# 611107, RRID:AB_398420 Anti-RNA polymerase II subunit B1 (phospho CTD Ser-2), clone 3E10 Millipore Millipore Cat# 04-1571, RRID:AB_11212363 Anti-RNA polymerase II subunit B1 (phospho-CTD Ser-5), clone 3E8 Millipore Millipore Cat# 04-1572, RRID:AB_10615822 NCBP1/CBP80 Antibody Bethyl Bethyl Cat# A301-793A, RRID:AB_1211224 XRN2 antibody Bethyl Bethyl Cat# A301-103A, RRID:AB_2218876 DCP2 antibody Bethyl Bethyl Cat# A302-597A, RRID:AB_10555903 HSP 90alpha/beta (F-8) antibody Santa Cruz Biotechnology Santa Cruz Biotechnology Cat# sc-13119, RRID:AB_675659 Anti-Tubulin, beta E7 DSHB DSHB Cat# E7, RRID:AB_528499 Rabbit anti-H3K4me3 serum Shilatifard Laboratory Chemicals, Peptides, and Recombinant Proteins Flavopiridol Cayman Cat# 10009197 3-indole-acetic acid sodium salt Abcam Cat# ab146403 NVP-2 MedChemExpress Cat# HY-12214A Paraformaldehyde (Electron Microscopy Sciences) Fisher Scientific Cat# 50-980-487 Biotin-11-ATP PerkinElmer Cat# NEL544001EA Biotin-11-CTP PerkinElmer Cat# NEL542001EA Biotin-11-GTP PerkinElmer Cat# NEL545001EA Biotin-11-UTP PerkinElmer Cat# NEL543001EA RNA 5’ Pyrophosphohydrolase (RppH) NEB Cat# M0356S PNK NEB Cat# M0201L T4 RNA ligase I NEB Cat# M0204L Phusion Hot Start II DNA polymerase ThermoFisher Cat# F549S Terminator 5’-triphosphate dependent exonuclease Lucigen Cat# {"type":"entrez-protein","attrs":{"text":"TER51020","term_id":"1599868412","term_text":"TER51020"}} TER51020 Quick CIP NEB Cat# M0525S Proteinase K Roche Cat# 3115828001 Dynabeads Protein G ThermoFisher Cat# 10003D Protein A/G PLUS-Agarose Santa Cruz Biotechnology Cat# sc-2003 Dynabeads Streptavidin M-280 ThermoFisher Cat# 11205D 2% Agarose, PippinHT, 100-600 bp.10/pkg. .. Sage science Cat# HTC2010 Critical Commercial Assays HTP Library Preparation Kit KAPA Biosciences Cat# KK8234 Agencourt AMPure XP Beckman Coulter Cat# A63882 Deposited Data Raw and processed data This paper GEO: {"type":"entrez-geo","attrs":{"text":"GSE144786","term_id":"144786"}} GSE144786 Human reference genome GRCh37/hg19 Genome Reference Consortium https://www.ncbi.nlm.nih.gov/grc/human Drosophila reference genome BDGP Release 5/dm3 Genome Reference Consortium Ensembl version 75 http://www.ensembl.org/ RNAPII-nucleosome structure SHL(−5) ( Kujirai et al., 2018 ) PDB: 6A5P RNAPII-nucleosome structure SHL (−1) ( Kujirai et al., 2018 ) PDB: 6A5T Pol II-NELF structure {Vos:2018cp} PDB: 6GML Complex of human nuclear cap-binding complex with m7GTP and NELFe c-terminal peptide ( Schulze and Cusack, 2017 ) PDB: 5OOB DLD1_normoxia_nucleosome ( Yamashita et al., 2011 ) https://www.ncbi.nlm.nih.gov/sra/DRX000003 Experimental Models: Cell Lines DLD-1 OsTIR1 ( Holland et al., 2012 ) N/A NELF-C-AID DLD-1 OsTIR1 #7-10B This paper N/A NELF-E-AID DLD-1 OsTIR1 #20-1B This paper N/A Mouse embryonic fibroblasts Stem cell technology cat# 00325 S2-DGRC DGRC FlyBase: FBtc0000006 Recombinant DNA YNP37 (Donor plasmid: NELF-C-AID_Neo) This paper N/A YNP38 (Donor plasmid: NELF-C-AID_Hyg) This paper N/A YNP39 (Cas9 plasmid for NELF-C, gRNA: CTGCAAATCTAACTTCATCA) This paper N/A YNP41 (Cas9 for NELF-E, gRNA: CTACAGTGATGACGTCTACA) This paper N/A YNP47 (Donor plasmid: NELF-E-AID_Neo) This paper N/A YNP48 (Donor plasmid: NELF-E-AID_Hyg) This paper N/A Software and Algorithms Bowtie 2.2.6 ( Langmead and Salzberg, 2012 ) BEDTools 2.25.0 ( Quinlan and Hall, 2010 ) R 3.3.3 https://www.r-project.org/ deepTools 3.0.0/3.1.1/3.1.2 ( Ramírez et al., 2016 ) Bowtie 1.1.2 ( Langmead et al., 2009 ) iNPS 1.2.2 ( Chen et al., 2014 ) HOMER 4.10/4.11 ( Duttke et al., 2019 ; Heinz et al., 2010 ) RUVseq ( Risso et al., 2014 ) DESeq2 ( Love et al., 2014 ) Trimmomatic 0.33 ( Bolger et al., 2014 ) cutadapt 1.14 ( Martin, 2011 ) intervene 0.6.4 ( Khan and Mathelier, 2017 ) featureCounts 2.0.0 ( Liao et al., 2014 ) Open in a separate window KEY RESOURCES TABLE Acute NELF depletion reveals a 2-step pausing of Pol II at promoters The 1st to 2nd pausing transition is independent of P-TEFb/SEC activity The heat shock response remains intact in the absence of NELF NELF recruits the cap binding complex with modest effects on 5’ cap stability
Electron Microscopy:Article Title: NELF regulates a promoter-proximal step distinct from RNA Pol II pause-release
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TH1L (D5G6W) Rabbit mAb (NELFC/D) Cell Signaling Cell Signaling Technology Cat# 12265, RRID:AB_2797862 Recombinant Anti-NELFe antibody [ {"type":"entrez-protein","attrs":{"text":"EPR11600","term_id":"523377171","term_text":"EPR11600"}} EPR11600 ] Abcam Abcam Cat# ab170104, RRID:AB_2827280 Purified Mouse Anti-DSIF Clone 17/DSIF (SPT5) BD Biosciences BD Biosciences Cat# 611107, RRID:AB_398420 Anti-RNA polymerase II subunit B1 (phospho CTD Ser-2), clone 3E10 Millipore Millipore Cat# 04-1571, RRID:AB_11212363 Anti-RNA polymerase II subunit B1 (phospho-CTD Ser-5), clone 3E8 Millipore Millipore Cat# 04-1572, RRID:AB_10615822 NCBP1/CBP80 Antibody Bethyl Bethyl Cat# A301-793A, RRID:AB_1211224 XRN2 antibody Bethyl Bethyl Cat# A301-103A, RRID:AB_2218876 DCP2 antibody Bethyl Bethyl Cat# A302-597A, RRID:AB_10555903 HSP 90alpha/beta (F-8) antibody Santa Cruz Biotechnology Santa Cruz Biotechnology Cat# sc-13119, RRID:AB_675659 Anti-Tubulin, beta E7 DSHB DSHB Cat# E7, RRID:AB_528499 Rabbit anti-H3K4me3 serum Shilatifard Laboratory Chemicals, Peptides, and Recombinant Proteins Flavopiridol Cayman Cat# 10009197 3-indole-acetic acid sodium salt Abcam Cat# ab146403 NVP-2 MedChemExpress Cat# HY-12214A Paraformaldehyde (Electron Microscopy Sciences) Fisher Scientific Cat# 50-980-487 Biotin-11-ATP PerkinElmer Cat# NEL544001EA Biotin-11-CTP PerkinElmer Cat# NEL542001EA Biotin-11-GTP PerkinElmer Cat# NEL545001EA Biotin-11-UTP PerkinElmer Cat# NEL543001EA RNA 5’ Pyrophosphohydrolase (RppH) NEB Cat# M0356S PNK NEB Cat# M0201L T4 RNA ligase I NEB Cat# M0204L Phusion Hot Start II DNA polymerase ThermoFisher Cat# F549S Terminator 5’-triphosphate dependent exonuclease Lucigen Cat# {"type":"entrez-protein","attrs":{"text":"TER51020","term_id":"1599868412","term_text":"TER51020"}} TER51020 Quick CIP NEB Cat# M0525S Proteinase K Roche Cat# 3115828001 Dynabeads Protein G ThermoFisher Cat# 10003D Protein A/G PLUS-Agarose Santa Cruz Biotechnology Cat# sc-2003 Dynabeads Streptavidin M-280 ThermoFisher Cat# 11205D 2% Agarose, PippinHT, 100-600 bp.10/pkg. .. Sage science Cat# HTC2010 Critical Commercial Assays HTP Library Preparation Kit KAPA Biosciences Cat# KK8234 Agencourt AMPure XP Beckman Coulter Cat# A63882 Deposited Data Raw and processed data This paper GEO: {"type":"entrez-geo","attrs":{"text":"GSE144786","term_id":"144786"}} GSE144786 Human reference genome GRCh37/hg19 Genome Reference Consortium https://www.ncbi.nlm.nih.gov/grc/human Drosophila reference genome BDGP Release 5/dm3 Genome Reference Consortium Ensembl version 75 http://www.ensembl.org/ RNAPII-nucleosome structure SHL(−5) ( Kujirai et al., 2018 ) PDB: 6A5P RNAPII-nucleosome structure SHL (−1) ( Kujirai et al., 2018 ) PDB: 6A5T Pol II-NELF structure {Vos:2018cp} PDB: 6GML Complex of human nuclear cap-binding complex with m7GTP and NELFe c-terminal peptide ( Schulze and Cusack, 2017 ) PDB: 5OOB DLD1_normoxia_nucleosome ( Yamashita et al., 2011 ) https://www.ncbi.nlm.nih.gov/sra/DRX000003 Experimental Models: Cell Lines DLD-1 OsTIR1 ( Holland et al., 2012 ) N/A NELF-C-AID DLD-1 OsTIR1 #7-10B This paper N/A NELF-E-AID DLD-1 OsTIR1 #20-1B This paper N/A Mouse embryonic fibroblasts Stem cell technology cat# 00325 S2-DGRC DGRC FlyBase: FBtc0000006 Recombinant DNA YNP37 (Donor plasmid: NELF-C-AID_Neo) This paper N/A YNP38 (Donor plasmid: NELF-C-AID_Hyg) This paper N/A YNP39 (Cas9 plasmid for NELF-C, gRNA: CTGCAAATCTAACTTCATCA) This paper N/A YNP41 (Cas9 for NELF-E, gRNA: CTACAGTGATGACGTCTACA) This paper N/A YNP47 (Donor plasmid: NELF-E-AID_Neo) This paper N/A YNP48 (Donor plasmid: NELF-E-AID_Hyg) This paper N/A Software and Algorithms Bowtie 2.2.6 ( Langmead and Salzberg, 2012 ) BEDTools 2.25.0 ( Quinlan and Hall, 2010 ) R 3.3.3 https://www.r-project.org/ deepTools 3.0.0/3.1.1/3.1.2 ( Ramírez et al., 2016 ) Bowtie 1.1.2 ( Langmead et al., 2009 ) iNPS 1.2.2 ( Chen et al., 2014 ) HOMER 4.10/4.11 ( Duttke et al., 2019 ; Heinz et al., 2010 ) RUVseq ( Risso et al., 2014 ) DESeq2 ( Love et al., 2014 ) Trimmomatic 0.33 ( Bolger et al., 2014 ) cutadapt 1.14 ( Martin, 2011 ) intervene 0.6.4 ( Khan and Mathelier, 2017 ) featureCounts 2.0.0 ( Liao et al., 2014 ) Open in a separate window KEY RESOURCES TABLE Acute NELF depletion reveals a 2-step pausing of Pol II at promoters The 1st to 2nd pausing transition is independent of P-TEFb/SEC activity The heat shock response remains intact in the absence of NELF NELF recruits the cap binding complex with modest effects on 5’ cap stability
|
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
